variation and race

An environmental stress that can negatively impact the survival of humans by disturbing homeostasis is heat. Heat can negatively impact the human body by causing heat exhaustion. Heat exhaustion happens when the body has lost too much fluid and salt. You start sweat excessively, feel fatigued, and nausea may set in. Heat exhaustion can then turn into heat stroke which can be dire.

One way the human body can adapt to heat for a short amount of time is by sweating. When the body starts to sweat it releases heat. The sweat cools down the body through evaporative cooling. Evaporative cooling is when sweat evaporated off the skin causing the skin to cool down.

A Facultative adaptation humans have for heat is vasodilation. Vasodilation is when capillaries that are close to the skin open up close to skin so heat can be lost through the skin.

A developmental adaptation to heat that humans have is, bipedalism. Bipedalism is a locomotion that means an organism that walks on two limbs instead of four. Since humans stand on two feet less sun is able to hit our bodies all at once making it easier for the body to stay in the shade and staying cool.

A cultural adaptation to heat would be air conditionings. Air conditionings work by drastically cooling down a room or building on a hot day. By having a cooler environment the body is able to relax once out of the heat.

The benefits from studying human variation from this perspective across environmental clines is that we mass amounts of different information that helps us become knowledgeable on how to survive in hot climates. Because of this information we know how to properly take care of ourselves like staying hydrated and not overworking ourselves.

I would not use race to understand the variation of race i listed in question number two because the color of someone’s skin has nothing to do with helping the body cope from heat stress. Skin color can help with radiation and blocking uv rays and it cannot block out heat.

Language

1)

I asked my boyfriend do do this experiment with me just because I was curious at how the conversation would go and how he would react, since he knew me, and my body language very well. At first he was a little confused as to how to react and just started asking me a lot of yeas and no questions which wasn’t very challenging for either of us. After a few minutes into the first part of the experiment we both started to get goofier with each other and had a lot of fun with the experiment and how sometimes he would misinterpret what i was trying to say back to him. I definitely saw a change in the way my boyfriend communicated with me. He would try not to be to complex with questions so that i could respond with more simple reactions.

My boyfriend was definitely in control of the conversation the whole time. He was able to manipulate the conversation easily because he was able to communicate to me fast and more precise/ detailed than I could. Most of the time all I could do was react to what he was saying and express how i felt with facial reactions. He would shoot off multiple questions at once time and I could hardly keep up with him in the conversation. I don’t think that I was able to squeeze in a question or really knew how to ask a question, so I was really the only only one answering the questions.

If my boyfriend and I represented two different kinds of cultures, the culture that my boyfriend represents would have the advantage in communicating complex ideas within this population. The culture that can use spoken language might look down on or feel more superior than the culture that can only use eye and body movements to communicate. A situation in real life that compares to these two cultures trying to communicate with each other would be a mother and her child.

Part 2)

My boyfriend and I found the second part of the experiment to be extremely awkward and confusing in some situations. Through this experiment you could only rely on spoken words and that is it making it hard to understand not what people are saying but the emotions and intentions behind what I was saying. He was having a hard time understanding if i was trying to crack a joke, being sassy, or being completely serious most of the time and it started to get a little bit annoying in some ways.

This experiment shows that our use of signs in our language is important in the way we communicate. It helps our emotions sign through making it easier for other people to gauge how they should react. It is the best way for human beings to react and show emotion towards other humans or objects.

Being able to read body language makes it so that humans can understand each other and add depth to what they are trying to convey at the time. Reading some bodies body language can help in situations like hunting. When two people are hunting an animal together, they can use body language instead of speaking to each other verbally so they can sneak up on the animal so that it doesn’t run away.

Yes, there are people that have certain disorders that make it hard for them to read people's emotions and body languages. A situation of not being able to use body language as a means of communication would be when texting somebody over the phone. There is still communication but you cannot actually read the other person's body to see how they are feeling or if they are using sarcasm for example.

Piltdown

1.    The Pildown hoax was one of the biggest hoax in scientific history, if not the biggest. In 1912 a fossil that was believed to be the earliest human relative known to man was unearthed in Pildown  England by a man named, Charles Dawson. During this time period across Europe scientists were finding many new evidence of early human relatives, such as fossils, tools, and paintings. While other countries were making these amazing discoveries, England still hadn't made a significant discovery of any sorts. So when Charles Dawson and his team uncovered a fossilized jaw bone and a tooth of what was perceived to be the earliest man alive in England it made world news. It wasn't until around 40 years later that scientists were able to measure the fluorine content the bones  and discovered that both bones were much younger than they were expected to be. The jaw bone actually turned out to be a female orangutans jaw that was stained to look aged. The tooth was also just filed down and painted over to fit the characteristics of a human tooth.

2.   People have a lot of faults especially when it comes to being envious and competitive. I think that Charles Dawson and other scientists in England wanted to show other countries, especially Germany that they were number one and that the English were technically here first. These faults negatively impacted the scientific process because people wanted to believe that these were the actual remains of our ancestors that the proper tests to verify how old the bones actually are.

3. 40 years later in measured the fluorine content and revealed that the fossil was not old enough to be the earliest human relative on Earth. But it wasn't until a few years later that scientists did a full scan of  the fossils and discovered that the tooth was filed down and painted and the jaw was stained to look older than what it truly was.

4. I don't think that it is possible to remove the "human" factor out of science, but i do think that we can prevent these human errors more by recording and double checking evidence.

5. A lesson I could take from the Pildown hoax would be to always not believe everything and to do your own research before making assumptions. There's a lot of people and establishments that will say anything to have your support, and out of greediness.

Homologous and Analogous Traits

Homologous Traits

A.  Even though a human (photo on the left) and a bird (photo on the upper right) seem as if they have don’t have anything in common, they actually do. As you can see in the photo on the right a human has the same exact bones in their arm that a bird has in their wing, meaning that they have  homologous traits. Even though humans are mammals that live with their feet on the ground and birds are covered in feathers and can fly in the air, they are still similar.

B. Both humans and birds share the same bones including: Humerus, carpals, metacarpals, radius, ulna, and phalanges. Even though humans and birds have this homologous trait, the way they evolved has created some very easy to see differences. As you can see even though humans and birds have the same bones they do not possess the same limbs. Humans have arms, hands, and fingers so they can grab, reach, and even drive a car. While bird’s bones have evolved so that they can fly in the air.

C. Although we do not know who the common ancestor of humans and birds actually is, scientist have come up with a general idea of what species both birds and humans have derived from. A team of scientist have been able to gain a large amount of information about the species. It has been concluded that both species had evolved from a small creature that lived off of insects. (pictured on the right)

Analogous Traits

1. Even though ducks(left) and platypus(right) share a lot of similar traits with each other, one is a mammal (platypus) and the other is a bird (duck). They both have bills, lay eggs, and have webbed feet, etc. As you can see in the two photos above a platypus basically looks like a cross between a duck and mammal making it seem as if they were related but in the end are from different ancestors.
2. One analogous trait between ducks and platypus is webbed feet. Even though both species possess webbed feet, platypus are able to retract the webbing on their feet so that they are able to burrow into the ground to nest and lay eggs. Ducks however are not able to retract the the webs on their feet making it impossible for them to burrow causing them to nest and lay eggs above ground. Even though there are differences between both of their feet they both still have the need to swim which is why they have both developed webbed feet.

Decoding

DNA: GATTACCTTTAAGTCTGAACAGGCTATAAATGCATCACT

Historical Influence

1. Thomas Malthus was a very influential person in the scientific world for many reasons, but he is the most well known for his theory of population growth.  Malthus had predicted that the human race would begin to populate so quickly that the production of resources would surely not be able to keep up. Malthus had advised putting population control into effect or else there would be dire consequences such as disease, famine, and war or other wise known as Malthusian catastrophes. https://www.boundless.com/sociology/textbooks/boundless-sociology-textbook/population-and-urbanization-17/population-growth-122/malthus-theory-of-population-growth-689-9631/
2. If there was one point that Darwin made that was directly affected by Malthus it would have to be that individuals themselves do not evolve, populations do. Darwin was able to build off of Malthus’ theory of population to make his own predictions on how, when, and why evolution occurs. Because of Malthus’ prediction that population would outgrow resources causing states of famine making it so that only organisms with  strong traits would survive ensuring the development of better traits in the next generation. Essentially individuals can not evolve they can only survive or die, making it so that over time certain traits will die out while others will live on.
3. If there was one point that Darwin made that was directly affected by Malthus it would have to be that individuals themselves do not evolve, populations do. Darwin was able to build off of Malthus’ theory of population to make his own predictions on how, when, and why evolution occurs. Because of Malthus’ prediction that population would outgrow resources causing states of famine making it so that only organisms with  strong traits would survive ensuring the development of better traits in the next generation. Essentially individuals can not evolve they can only survive or die, making it so that over time certain traits will die out while others will live on.
4. The Church strongly affected Darwin and his decision to publish his theory because, in the 19th Century the church had a lot more power than it does now. Darwin’s theory went against everything the churched believed in when it came to the idea that God created the universe which angered the church. Darwin became discouraged about publishing his theory because he knew it would cause religious controversy.