Homologous and Analogous Traits

Homologous Traits

A.  Even though a human (photo on the left) and a bird (photo on the upper right) seem as if they have don’t have anything in common, they actually do. As you can see in the photo on the right a human has the same exact bones in their arm that a bird has in their wing, meaning that they have  homologous traits. Even though humans are mammals that live with their feet on the ground and birds are covered in feathers and can fly in the air, they are still similar.

B. Both humans and birds share the same bones including: Humerus, carpals, metacarpals, radius, ulna, and phalanges. Even though humans and birds have this homologous trait, the way they evolved has created some very easy to see differences. As you can see even though humans and birds have the same bones they do not possess the same limbs. Humans have arms, hands, and fingers so they can grab, reach, and even drive a car. While bird’s bones have evolved so that they can fly in the air.

C. Although we do not know who the common ancestor of humans and birds actually is, scientist have come up with a general idea of what species both birds and humans have derived from. A team of scientist have been able to gain a large amount of information about the species. It has been concluded that both species had evolved from a small creature that lived off of insects. (pictured on the right)

Analogous Traits

1. Even though ducks(left) and platypus(right) share a lot of similar traits with each other, one is a mammal (platypus) and the other is a bird (duck). They both have bills, lay eggs, and have webbed feet, etc. As you can see in the two photos above a platypus basically looks like a cross between a duck and mammal making it seem as if they were related but in the end are from different ancestors.
2. One analogous trait between ducks and platypus is webbed feet. Even though both species possess webbed feet, platypus are able to retract the webbing on their feet so that they are able to burrow into the ground to nest and lay eggs. Ducks however are not able to retract the the webs on their feet making it impossible for them to burrow causing them to nest and lay eggs above ground. Even though there are differences between both of their feet they both still have the need to swim which is why they have both developed webbed feet.

Decoding

DNA: GATTACCTTTAAGTCTGAACAGGCTATAAATGCATCACT

Historical Influence

1. Thomas Malthus was a very influential person in the scientific world for many reasons, but he is the most well known for his theory of population growth.  Malthus had predicted that the human race would begin to populate so quickly that the production of resources would surely not be able to keep up. Malthus had advised putting population control into effect or else there would be dire consequences such as disease, famine, and war or other wise known as Malthusian catastrophes. https://www.boundless.com/sociology/textbooks/boundless-sociology-textbook/population-and-urbanization-17/population-growth-122/malthus-theory-of-population-growth-689-9631/
2. If there was one point that Darwin made that was directly affected by Malthus it would have to be that individuals themselves do not evolve, populations do. Darwin was able to build off of Malthus’ theory of population to make his own predictions on how, when, and why evolution occurs. Because of Malthus’ prediction that population would outgrow resources causing states of famine making it so that only organisms with  strong traits would survive ensuring the development of better traits in the next generation. Essentially individuals can not evolve they can only survive or die, making it so that over time certain traits will die out while others will live on.
3. If there was one point that Darwin made that was directly affected by Malthus it would have to be that individuals themselves do not evolve, populations do. Darwin was able to build off of Malthus’ theory of population to make his own predictions on how, when, and why evolution occurs. Because of Malthus’ prediction that population would outgrow resources causing states of famine making it so that only organisms with  strong traits would survive ensuring the development of better traits in the next generation. Essentially individuals can not evolve they can only survive or die, making it so that over time certain traits will die out while others will live on.
4. The Church strongly affected Darwin and his decision to publish his theory because, in the 19th Century the church had a lot more power than it does now. Darwin’s theory went against everything the churched believed in when it came to the idea that God created the universe which angered the church. Darwin became discouraged about publishing his theory because he knew it would cause religious controversy.